* bits * Ri 2.71 * * Ri(b,l) table is from: ** rseq 5.39 rsequence calculated from encoded sequences from: ** encode 1.41; encoding of sequences in ** * 2003/11/18 21:35:49, 1995/12/04 06:41:55, t7.symmetry * * BOOK/INST sequences are from: * 2003/11/18 21:35:49, 1995/12/04 06:41:55, t7.symmetry * (* begin module t7.symmetry *) * * PARAMETERS FOR Ri: * -10 10 from-to * 1 column of value file * -2147483647.000000 2147483647.000000 lowest to highest Ri selected * -2147483647.000000 2147483647.000000 lowest to highest Value selected * not printing sequences to sequ * printing sequences to rixyin * -: whole line printed when partial site * using Staden's Method: when f(b,l) = 0, replace with f(b,l) = 1/(n+t), t = 2 * * i alignmenttype first, book, instructions * Lengths file: * empty * * data are from -50 to 50 * book/inst alignment is from -50 to 50 * Ri analysis is from -10 to 10 * * Columns: * 1 piece number * 2 piece name * 3 sequence region analyzed (if printed, - if not) * 4 length of region analyzed on this piece * 5 aligning coordinate on piece * 6 Rindividual for the piece * 7 value from the values file * 8 standard deviation of Rindividual for that sequence * 1 t7 acaactcactataaggagaga 21 402 18.978666 0.000000 1.836611 2 t7 gtctctccttatagtgagttg 21 403 16.315701 0.000000 2.676227 3 t7 acgactcactatagagggaca 21 5845 22.815404 0.000000 0.986633 4 t7 ttgtccctctatagtgagtcg 21 5846 21.737402 0.000000 1.106228 5 t7 acgactcactataggagaacc 21 5920 21.548812 0.000000 0.641401 6 t7 aggttctcctatagtgagtcg 21 5921 21.548812 0.000000 0.641401 7 t7 acgactcagtatagggacaat 21 6406 14.849383 0.000000 7.855885 8 t7 cattgtccctatactgagtcg 21 6407 12.186418 0.000000 9.508200 9 t7 acgactcactaaaggaggtac 21 7775 20.308708 0.000000 0.800097 10 t7 tgtacctcctttagtgagtcg 21 7776 19.230706 0.000000 0.908135 11 t7 acgactcactaaaggagacac 21 7892 14.575354 0.000000 2.268445 12 t7 agtgtctcctttagtgagtcg 21 7893 14.575354 0.000000 2.268445 13 t7 acgactcactattagggaaga 21 9104 12.238278 0.000000 5.343890 14 t7 gtcttccctaatagtgagtcg 21 9105 9.575313 0.000000 6.720472 15 t7 tgaactcactaaagggagacc 21 11177 21.166803 0.000000 0.861439 16 t7 tggtctccctttagtgagttc 21 11178 21.166803 0.000000 0.861439 17 t7 ccgactcactaaagagagaga 21 12668 17.563919 0.000000 2.201345 18 t7 atctctctctttagtgagtcg 21 12669 20.226884 0.000000 1.447188 19 t7 acgactcactaaaggagacac 21 13338 14.575354 0.000000 2.268445 20 t7 tgtgtctcctttagtgagtcg 21 13339 13.497351 0.000000 2.448021 21 t7 tcgactcactataggagatat 21 13912 17.111407 0.000000 1.797258 22 t7 aatatctcctatagtgagtcg 21 13913 18.189409 0.000000 1.643880 23 t7 acgactcactatagggagata 21 18541 24.932862 0.000000 0.543868 24 t7 ctatctccctatagtgagtcg 21 18542 22.269897 0.000000 1.036682 25 t7 acgactcactatagggagacc 21 21861 28.517824 0.000000 0.133409 26 t7 aggtctccctatagtgagtcg 21 21862 28.517824 0.000000 0.133409 27 t7 acgactcactatagggagacc 21 22900 28.517824 0.000000 0.133409 28 t7 tggtctccctatagtgagtcg 21 22901 27.439822 0.000000 0.179548 29 t7 acgactcactatagggagaac 21 27270 26.780859 0.000000 0.232246 30 t7 tgttctccctatagtgagtcg 21 27271 25.702856 0.000000 0.292030 31 t7 acgactcactatagggagagg 21 34562 27.517824 0.000000 0.211321 32 t7 gcctctccctatagtgagtcg 21 34563 24.854859 0.000000 0.548189 33 t7 acgactcactatagggagagg 21 39225 27.517824 0.000000 0.211321 34 t7 tcctctccctatagtgagtcg 21 39226 26.439822 0.000000 0.268506